Doulix News

DNA studio – Synthetic Biology epistemology, SBOL & annotations.

Davide De Lucrezia

We’ve kitted out DNA studio with a powerful toolkit to empower the principals of Synthetic Biology:  standarisation, modularity, characterisation and interoperability. To ensure relevance, flexibility and ease of use we carefully considered the theoretical framework around which DNA studio should be built. 

One of the hallmarks of synthetic biology is standardization [1] of both DNA parts and related data in order to ensure interoperability between systems, for search, integration and exchange.

Data standardization and knowledge management ultimately go back to epistemology and theory of knowledge [2]. 

At Doulix, we follow the path of constructivist epistemology after the teaching of Piaget [3], Maturana and Varela, and, within Synthetic Biology, Luisi [4 ]. 

We assume that knowledge expresses our understanding of a specific object at a specific time and necessarily reflects our cognitive pattern and cultural background.

 

Synthetic Biology epistemology

Within this framework, DNA studio is based on some assumptions:

  • The object- the object of knowledge is the entity under observation. In DNA studio this object is any DNA or amino acid sequences and it is captured and stored as a Biomodule. For instance, the sequence TAATACGACTCACTATAGGGAATACAAGCTACTTGTTCTTTTTGCA is an object and it is stored as biomodule 716RON, regardless of its potential or actual function.
  • Object attributes.
    Attributes define the features of objects and they are abstractions that should reflect what we think the object can do. In DNA studio, attributes are represented by annotations of biological functions appended to a DNA or amino acid sequence. For instance, the biomodule MGEC526 is annotated as promoter from nt 295 to nt 351 and as coding sequence from nt 484 to nt 1443. It should be noted that attributes/annotations are an observer-dependent description of the object with different degrees of validity and accuracy 

 

Shaping DNA studio

This epistemological and theoretical framework shaped the way we designed and implemented DNA studio’s data structure and algorithms.

For instance, biological functions are linked to annotations rather than sequences. Annotations work as an intermediate layer that links biological functions to sequences.

This approach comes in handy when modifying or engineering sequences that are linked to multiple biological functions.

Since each function is linked to a given annotation any change/deletion in the DNA sequence spanning that annotation will affect also the corresponding biological function.

This allows the automatic updating of biological functions of DNA studio’s entries.For instance, if one deleted the region between nt 295 and nt 351 from biomodule MGEC526, the correspondent list of associated functions would be automatically updated by removing the promoter function.

This unsupervised maintenance would be difficult if the biological function (i.e. DNA sequence promoting the initiation of RNA transcription) were associated directly to the object (i.e. the DNA sequence) rather than to its attribute (i.e. annotation promoter).

On these premises, we built DNA studio with its repositories, sequence designer and modelling algorithms.

Naturally, the principles above are not sufficient to account for the extraordinary complexity found in biology.

This document simply introduces our contribution to (and defines where we stand in) the current epistemological debate in synthetic biology.Below we provide an essential reference to map DNA studio’s biological annotations to Sequence Ontology terms (SO) and SBOL Visual (SBOL).

Whenever possible, we try to comply with both standards.

 

Doulix AnnotationSO termSBOL temVisual
Promoter/OperatorSO:0000167
SO:0000409
Promotor site
Operator binding site
5′-UTRSO:0000204n.a.
Coding SequenceSO:0000316CDS
3′-UTRSO:0000205n.a.
TerminatorSO:0000141Terminator
Plasmid BackboneSO:0000755n.a.
non-coding RNASO:0001263Non-Coding RNA Gene
Compositen.a.Composite
Unknown/OtherSO:0000110Unspecified
Hinge/Restriction siteSO:0001687DNA cleavage site
Primer/Oligo/ProbeSO:0005850Primer binding site

 

We will keep adding new annotations in the next months, stay tuned!

References

[1] Drew Endy. Foundations for engineering biology. Nature, Vol 438 (24). 2005.

[2] Carl J. Wenning Scientific epistemology: How scientists know what they know. J. Phys. Tchr. Educ. Online, 5 (2). 2009.

[3] Ernst von Glasersfeld. An Exposition of Constructivism: Why Some Like it Radical. Ed. Massachusetts Univ., Amherst. Scientific Reasoning Research Institute. 1990.

[4] Humberto R. Maturana, Michel Bitbol & Pier Luigi Luisi. The Transcendence of the Observer. Constructivist Foundations, 7, 2012.

 

Acknowledgment

Credits to Stefano Maria Marino and Serena Marletta from Explora Biotech for their contributions to the ideas discussed here. Special thanks to Luisa Damiano (Univ. of Messina, Italy) and Marco Rugliancich for the fruitful discussions.

Explore BioModules

Explore the world’s largest library of lab-tested parts – BioModules. Quickly search, select and edit in DNA studio.

Explore Constructs

Explore a catalogue of ‘ready for research’ constructs made by some of the world’s top labs.